IthaID: 4124
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | IVS II-82 G>C | HGVS Name: | HBA2:c.301-61G>C |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CAGAGGATCACGCGGGTTGCG [G>C] GAGGTGTAGCGCAGGCGGCGG (Strand: +)
Comments: The c.301-61G>C variant is an intron variant in the HBA2 gene, identified in a heterozygous state with mild anemia. The variant was identified through Sanger sequencing. It was published as HBA2:c.300+82G>C.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | Anaemia [HP:0001903] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34274 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Chinese/Inner Mongolia |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Zhang H, Wang Z, Yang Z, Chen X, Xu H, Zeng X, Yu Q, Kong L, Zhang R, Yi J, Wu J, Gan Y, Chen Y, Ye A, Wang Z, Zhang D, Han X, Du J, Dou Y, Analysis of genotypic distribution and rare variants of patients with α/β-thalassemia screened in one hospital in Beijing, China., Hum Genomics, 19(1), 13, 2025 PubMed
Created on 2025-03-11 14:57:51,
Last reviewed on 2025-03-11 14:59:19 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.