IthaID: 4146

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: Poly A +70 (G>A) HGVS Name: HBD:c.*200G>A
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AGGTTCCTGAGGCTCTACAGATAG [G>A] GAGCACTTGTTTATTTTACAAAGA (Strand: -)

Comments: The c.*200G>A substitution is located in the polyadenylation signal site of the HBD gene. It was identified in the heterozygous state alongside a missense variant in the HBD gene [IthaID: 4091], in trans, in a clinically asymptomatic adult. Hematological parameters: Hb 16.2 g/dL, RBC 5.16 × 10^12/L, MCV 91.5 fL, MCH 31.4 pg.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 64852
Size: 1 bp
Located at: δ
Specific Location: Poly(A)

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Long XG, He X, Zheng LH, Liang L, Qin T, Li YQ, Hb A-Guangxi [δ79 (EF3) Asp→Asn, : C.238G > A] and polyA + 70 (: C.*200G > A): Two Novel δ-Globin Gene Mutations Identified in a Chinese Family., Hemoglobin, 48(4), 265-269, 2024
Created on 2025-03-19 12:16:33, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.