
IthaID: 4146
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | Poly A +70 (G>A) | HGVS Name: | HBD:c.*200G>A |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AGGTTCCTGAGGCTCTACAGATAG [G>A] GAGCACTTGTTTATTTTACAAAGA (Strand: -)
Comments: The c.*200G>A substitution is located in the polyadenylation signal site of the HBD gene. It was identified in the heterozygous state alongside a missense variant in the HBD gene [IthaID: 4091], in trans, in a clinically asymptomatic adult. Hematological parameters: Hb 16.2 g/dL, RBC 5.16 × 10^12/L, MCV 91.5 fL, MCH 31.4 pg.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | δ-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 64852 |
| Size: | 1 bp |
| Located at: | δ |
| Specific Location: | Poly(A) |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Long XG, He X, Zheng LH, Liang L, Qin T, Li YQ, Hb A-Guangxi [δ79 (EF3) Asp→Asn, : C.238G > A] and polyA + 70 (: C.*200G > A): Two Novel δ-Globin Gene Mutations Identified in a Chinese Family., Hemoglobin, 48(4), 265-269, 2024
Created on 2025-03-19 12:16:33,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.