|
Functionality:
|
Globin gene causative mutation |
Pathogenicity:
|
N/A |
|
Common Name:
|
-276 A>G |
HGVS Name:
|
HBD:c.-326A>G |
|
Hb Name:
|
N/A |
Protein Info:
|
N/A |
|
Also known as:
|
|
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TACATTCCACTATATTAGCCT [A>G] AAACACTTCTGCAAAAATGAA (Strand: -)
Comments: The c.-326A>G variant in the HBD gene is located approximately 2 kb upstream and was initially identified in a Thai individual with Hb E trait and unusually low Hb A2 levels (1.7%). In the heterozygous state, either alone or co-inherited with an α-thalassemia variant, it is associated with near-normal Hb A2 levels (2.2–2.4%) and normal red cell indices (MCV, MCH). The authors propose that this variant is more likely a benign polymorphism than a pathogenic defect affecting δ-globin gene expression. However, further evidence is needed to confirm its clinical significance.
