IthaID: 4154

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -276 A>G HGVS Name: HBD:c.-326A>G
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TACATTCCACTATATTAGCCT [A>G] AAACACTTCTGCAAAAATGAA (Strand: -)

Comments: The c.-326A>G variant in the HBD gene is located approximately 2 kb upstream and was initially identified in a Thai individual with Hb E trait and unusually low Hb A2 levels (1.7%). In the heterozygous state, either alone or co-inherited with an α-thalassemia variant, it is associated with near-normal Hb A2 levels (2.2–2.4%) and normal red cell indices (MCV, MCH). The authors propose that this variant is more likely a benign polymorphism than a pathogenic defect affecting δ-globin gene expression. However, further evidence is needed to confirm its clinical significance.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 62857
Size: 1 bp
Located at: δ
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Panyasai S, Prayalaw P, Singha K, Fucharoen S, Molecular and hematological characteristics of two different δ-globin promoter variants, δ and δ among Thai, Burmese, and Laotian subjects., PeerJ, 13(0), e19636, 2025
Created on 2025-07-24 09:14:09, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.