IthaID: 4175
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | TTS +39 C>A | HGVS Name: | HBA1:c.*150C>A |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGAGTTTTTTCCCTCAGCAAACGTG [C>A] CAGGCATGGGCGTGGACAGCAGCT (Strand: +)
Comments: Missense variant located 39 nucleotides downstream of the transcription termination signal. The variant lies within regulatory elements of the HBA1 3′UTR and is predicted to disrupt post-transcriptional regulation through potential interference with HuR and/or miRNA binding, leading to reduced mRNA stability. It was identified in a 31-year-old Moroccan woman with microcytosis and no history of blood transfusions.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 38424 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | Moroccan |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Benito SF, Abío M, Bardón-Cancho EJ, Nieto JM, Ortega B, González FA, Villegas A, Benavente C, Ropero P, Importance of the 3'UTR region in globin synthesis: identification of two novel HBA1 mutations causing α-Thalassemia., Ann Hematol, 2025
Created on 2025-12-17 15:22:02,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.