IthaID: 4181

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS I-9 C>T HGVS Name: HBA1:c.95+9C>T
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGAGGCCCTGGAGAGGTGAGGCT [C/T] CCTCCCCTGCTCCGACCCGGGCTC (Strand: +)

Comments: Identified in a 1-year-old boy presenting with reduced MCV and MCH levels and hypochromic microcytic anaemia. In silico pathogenicity prediction using MutationTaster suggested that this variant may affect protein function and alter splice sites; however, it was classified as a polymorphism by the same predictor.

External Links

dbSNP ClinVar

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37683
Size: 1 bp
Located at: α1
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Splice junction (mRNA Processing)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Huang, Huiying2026-03-16First report.
Created on 2026-03-31 10:00:39, Last reviewed on 2026-03-31 10:05:54 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2026-03-31 10:05:54