
IthaID: 426
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | Poly A (AATAAA>AATA--) | HGVS Name: | HBA2:c.*93_*94delAA |
| Hb Name: | N/A | Protein Info: | α2 nts 818 - 819 deleted |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACCGGCCCTTCCTGGTCTTTGAATA [-/AA] GTCTGAGTGGGCAGCAGCCTGTGTG (Strand: +)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α+/α0 |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34556 |
| Size: | 2 bp |
| Located at: | α2 |
| Specific Location: | Poly(A) |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | RNA cleavage - Poly(A) signal (mRNA Processing) |
| Ethnic Origin: | Asian, Indian, Thai, Malaysian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Harteveld CL, Losekoot M, Haak H, Heister GA, Giordano PC, Bernini LF, A novel polyadenylation signal mutation in the alpha 2-globin gene causing alpha thalassaemia., British journal of haematology, 87(1), 139-43, 1994
- Hall GW, Higgs DR, Murphy P, Villegas A, de Miguel A, A mutation in the polyadenylation signal of the alpha 2 globin gene (AATAAA-->AATA--) as a cause of alpha thalassaemia in Asian indians., Br. J. Haematol. , 88(1), 225-7, 1994
- Viprakasit V, Ayyub H, May A, Dinucleotide deletion in -alpha3.7 allele causes a severe form of alpha+ thalassaemia., Eur. J. Haematol. , 71(2), 133-6, 2003
- Yasin NM, Hassan S, Aziz NA, Abdul Hamid FS, Esa E, Zulkefli ES, Ghazali R, Tajuddin SN, Darawi MN, Yusoff YM, Harteveld CL, The Clinical and Laboratory Profiles of a Deletional α2-Globin Gene Polyadenylation Signal Sequence (AATAAA > AATA--) [HBA2:c.*93_*94delAA]: The Malaysian Experience., Diagnostics (Basel), 15(10), 0, 2025
Created on 2010-06-16 16:13:15,
Last reviewed on 2025-06-30 13:01:33 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.