
IthaID: 828
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 7 (-GAG) [-Glu] | HGVS Name: | HBB:c.22_24delGAG |
| Hb Name: | Hb Leiden | Protein Info: | β7 (A4) Glu->0 |
| Also known as: | Hb Xinyi |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CATGGTGCATCTGACTCCTGAG [GAG/-] AAGTCTGCCGTTACTGCCCTGT (Strand: -)
Comments: In a recent unpublish report, it was found in a 6-month-old male in compound heterozygosity with Hb Q-Thailand [IthaID: 607] with no clinical presentation.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | Decreased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70616 |
| Size: | 3 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | American, Chinese, Mexican, Netherlands, South African, Yugoslavian, Dutch |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- De Jong WW, Went LN, Bernini LF, Haemoglobin Leiden: deletion of beta-6 or 7 glutamic acid., Nature, 220(5169), 788-90, 1968
- Jongbloed W, van Twillert G, Schoorl M, Schindhelm RK, Unstable haemoglobin variant Hb Leiden is detected on Sysmex XN-Series analysers., Clin Chem Lab Med, 56(9), e249-e250, 2018
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Li, Youqiong | 2021-06-03 | Report of an update. |
Created on 2010-06-16 16:13:16,
Last reviewed on 2022-09-15 11:30:39 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.