IthaID: 872



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 22-26 (-12bp) HGVS Name: HBB:c.69_80delAGTTGGTGGTGA
Hb Name: Hb Olinda Protein Info: β 22(B4) - 25(B7) Glu-Val-Gly-Gly->0

Context nucleotide sequence:
CCTGTGGGGCAAGGTGAACGTGGATGA [-/GAAGTTGG] GGCCCTGGGCAGGTTGGTATCAAG (Strand: -)

Also known as:

Comments: Found as a de novo variant in a proband from the State of Pernambuco, NE Brazil. Substitutions at codons 23 and 24, which are inside the haemoglobin molecule, lead to the production of variants with altered stability and function, presenting with haemolytic anaemia. Reported in literature as HBB:c.67_78delGAAGTTGGTGGT, which does not follow the HGVS Sequence Variant Nomeclature guidelines.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70663
Size: 12 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Brazilian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bezerra MA, Albuquerque DM, Santos MN, Kimura EM, Jorge SE, Oliveira DM, Domingues BL, Peres JC, Araújo AS, Costa FF, Sonati MF, Two new unstable haemoglobins leading to chronic haemolytic anaemia: Hb Caruaru [beta122 (GH5) Phe-->Ser], a probable case of germ line mutation, and Hb Olinda [beta22 (B4) - 25 (B7)], a deletion of a 12 base-pair sequence., European journal of haematology, 83(4), 378-82, 2009 PubMed
Created on 2010-06-16 16:13:16, Last reviewed on 2019-11-11 11:04:45 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.