IthaID: 1029
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 69 (+GCTCGG) | HGVS Name: | HBB:c.204_209dupGCTCGG |
| Hb Name: | Hb Nishinomiya | Protein Info: | β 69(E13) Gly->0 AND Gly-Leu-Gly- inserted between 68(E12) and 70(E14) of β |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AGGCTCATGGCAAGAAAGTGCTCGG [-/GCTCGG] TGCCTTTAGTGATGGCCTGGCTCAC (Strand: -)
Comments: Found in a patient with spherocytic hemolysis. This mutation resulted in the insertion of two amino acid residues β69GGT(Gly)>GGG(Gly)CTC(Leu)GGT(Gly). Insertion of Leu-Gly between positions 69(E13) and 70(E14) of the chain alters the amino acid residues of helix E in and around the heme pocket. Amino acid substitutions around position 70-73(E14-17) of the chain are likely to alter stability and oxygen affinity.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70928 |
| Size: | 5 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Japanese |
| Molecular mechanism: | Altered secondary structure |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Naito Y, Takahashi T, Matsunashi T, Harano K, Harano T, Hb Nishinomiya [Leu-Gly-inserted between codons 69(E13) and 70(E14) of beta]: a novel unstable hemoglobin with reduced oxygen affinity found in a patient with spherocytic hemolysis., International journal of hematology, 76(2), 146-8, 2002 PubMed
Created on 2010-06-16 16:13:16,
Last reviewed on 2019-11-13 10:02:17 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.