IthaID: 1100
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 93-97 (-15 bp) | HGVS Name: | HBB:c.280_294delTGTGACAAGCTGCAC |
Hb Name: | Hb Gun Hill | Hb GH | Protein Info: | β 91(F7) - 95(FG2) Leu-His-Cys-Asp-Lys->0 |
Context nucleotide sequence:
TTTGCCACACTGAGTGAGCTGCAC [-/TGTGACAAGCTGCAC] GTGGATCCTGAGAACTTCAGGGTGA (Strand: -)
Also known as:
Comments: Found in a heterozygous state in two members of a family with German and English ancestry, and presenting with mild compensated haemolysis. Found as a heterozygote in an assymptomatic black female living in Alabama; her parents and siblings did not carry the variant. The deleted residues occur in a region involved in heme-globin binding. The β-chains of Hb Gun Hill lack heme groups. Reported in literature as HBB:c.274_288del (α2β2 codons 91-95 deleted), which does not follow the HGVS Sequence Variant Nomeclature recommendations.
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-chain variant |
Allele Phenotype: | N/A |
Stability: | Unstable |
Oxygen Affinity: | Increased Oxygen Affinity |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71004 |
Size: | 15 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
Ethnic Origin: | English, German, African |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Bradley TB, Wohl RC, Rieder RF, Hemoglobin Gun Hill: deletion of five amino acid residues and impaired heme-globin binding., Science (New York, N.Y.), 157(796), 1581-3, 1967 PubMed
- Rieder RF, Synthesis of hemoglobin Gun Hill: increased synthesis of the heme-free beta-GH globin chain and subunit exchange with a free alpha-chain pool., J. Clin. Invest., 50(2), 388-400, 1971 PubMed
- Murari J, Smith LL, Wilson JB, Schneider RG, Huisman TH, Some properties of hemoglobin Gun Hill., Hemoglobin, 1(3), 267-82, 1977 PubMed
Created on 2010-06-16 16:13:16,
Last reviewed on 2019-11-07 15:31:33 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:16 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2019-11-07 15:31:33 | The IthaGenes Curation Team | Reviewed. Common name, HGVS name, Allele, Context sequence, Type of mutation, Location corrected. References and Comment added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2023-03-22 16:46:31