IthaID: 1195
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 112-116 (+GTGTGCTGGCCC) | HGVS Name: | HBB:c.338_349dupGTGTGCTGGCCC |
Hb Name: | Hb Antibes-Juan-Les-Pins | Protein Info: | β 116(G18) His->0 AND Arg-Val-Leu-Ala-His- inserted between 115(G17) and 117(G19) of β |
Context nucleotide sequence:
AACGTGCTGGTCTGTGTGCTGGCCC [-/GTGTGCTGGCCC] ATCACTTTGGCAAAGAATTCACCCC (Strand: -)
Also known as:
Comments: Found in a father and his two sons with abnormal haematological parameters. Amino acid residues at positions β115-β119 at the end of helix G in the normal β-globin chain are involved either in α1β1 subunit links or externally on the Hb molecule. The insertion of five amino acid residues leads to the addition of a complete helix turn that has no effect on oxygen binding but decreases molecule stability. Oxygen dissociation curves were normal.
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-chain variant |
Allele Phenotype: | N/A |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71912 |
Size: | 12 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | French, Greek |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Lacan P, Becchi M, Zanella-Cleon I, Aubry M, Quinsat D, Couprie N, Francina A, Identification by mass spectrometry of a hemoglobin variant with an elongated beta-globin chain., Clinical chemistry, 51(1), 213-5, 2005 PubMed
- Theodoridou S, Boutou E, Vyzantiadis TA, Balassopoulou A, Vlachaki E, First Report of a Coincidental Discovery of Hb Antibes-Juan-Les-Pins (: c.349_350insGTGTGCTGGCCC) in a Greek Woman., Hemoglobin, 44(5), 361-363, 2020 PubMed
Created on 2010-06-16 16:13:17,
Last reviewed on 2021-06-23 12:52:50 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:17 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2019-11-13 11:51:44 | The IthaGenes Curation Team | Reviewed. Mutation names, Allele and Location corrected. Comment added. |
4 | 2021-06-23 12:52:50 | The IthaGenes Curation Team | Reviewed. Origin and reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2023-03-22 16:46:31