IthaID: 1322
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | -77 T>C | HGVS Name: | HBD:c.-127T>C |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCTAATGCCCTGGCTCACAAGTACC [A/G] TTGAGATCCTGGACTGTTTCCTGAT (Strand: -)
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | δ-thalassaemia |
Allele Phenotype: | δ0 δ+ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 63056 |
Size: | 1 bp |
Located at: | δ |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Promoter (Transcription) |
Ethnic Origin: | Japanese, Chinese, Thai, Burmese, Laotian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Nakamura T, Takihara Y, Ohta Y, Fujita S, Takagi Y, Fukumaki Y, A delta-globin gene derived from patients with homozygous delta zero-thalassemia functions normally on transient expression in heterologous cells., Blood, 70(3), 809-13, 1987 PubMed
- Liu N, Xie XM, Zhou JY, Li R, Liao C, Li DZ, Analysis of δ-globin gene mutations in the Chinese population., Hemoglobin , 37(1), 85-93, 2013 PubMed
- Chen M, Huang H, Chen L, Lin N, Zhang M, Lin Y, Xu L, First report of the spectrum of δ-globin gene mutations among women of reproductive age in Fujian area-Discrimination of δ-thalassemia, α-thalassemia, and Iron Deficiency Anemia., J Clin Lab Anal, 34(11), e23479, 2020 PubMed
- Panyasai S, Prayalaw P, Singha K, Fucharoen S, Molecular and hematological characteristics of two different δ-globin promoter variants, δ and δ among Thai, Burmese, and Laotian subjects., PeerJ, 13(0), e19636, 2025 PubMed
Created on 2010-06-16 16:13:17,
Last reviewed on 2025-07-24 09:35:24 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.