IthaID: 1327



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -36 (C>A) HGVS Name: HBD:c.-86C>A
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GCTCACTGGAGCAGGGAGGACAGGA [A/C] CAGCATAAAAGGCAGGGCAGAGTCG (Strand: -)

Also known as:

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:δ+
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63097
Size: 1 bp
Located at: δ
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Papadakis M, Papapanagiotou E, Loutradi-Anagnostou A, Scanning method to identify the molecular heterogeneity of delta-globin gene especially in delta-thalassemias: detection of three novel substitutions in the promoter region of the gene., Human mutation, 9(5), 465-72, 1997 PubMed
Created on 2010-06-16 16:13:17, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.