
IthaID: 229
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 106 (CTG >GTG) Leu to Val | HGVS Name: | HBB:c.319C>G |
| Hb Name: | Hb L'Aquila | Protein Info: | β 106(G8) Leu>Val |
| Also known as: | Hb Federico II |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACCTCTTATCTTCCTCCCACAGCTC [C/G] TGGGCAACGTGCTGGTCTGTGTGCT (Strand: -)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | β+ Thalassaemia dominant |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71893 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Italian |
| Molecular mechanism: | Altered heme pocket |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Amato A, Cappabianca MP, Ponzini D, Rinaldi S, Biagio PD, Foglietta E, Grisanti P, Mastropietro F, Hb L'Aquila [beta106(G8)Leu-->Val, CTG-->GTG]: a novel thalassemic hemoglobin variant., Hemoglobin, 31(3), 375-8, 2007
- Grosso M, Palumbo I, Morelli E, Puzone S, Sessa R, Izzo P, Defective mRNA levels are responsible for a beta-thalassemia phenotype associated with Hb Federico II, a novel hemoglobin variant [beta-106 (G8) Leu->Val]., Haematologica , 93(7), 1096-8, 2008
Created on 2010-06-16 16:13:15,
Last reviewed on 2016-12-14 10:25:38 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.