
IthaID: 2564
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | 3'UTR +118 (A>G) | HGVS Name: | HBB:c.*118A>G |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: | 3'UTR +1592 (A>G) |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TCTGGATTCTGCCTAATAAAAAAC [A/G] TTTATTTTCATTGCAATGATGTAT (Strand: -)
Comments: Found in combination with CD 39 (C>T), diagnosed with β-thal intermedia. Carriers do not have hematological parameters associated with β-thal.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β++ (silent) |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72136 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Spanish |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Herrera MA, De La Fuente-Gonzalo F, González FA, Nieto JM, Dominguez AB, Villegas A, Ropero P, Identification of a novel mutation in the β-globin gene 3' untranslated region (HBB: c.*+118A > G) in Spain., Hemoglobin , 39(1), 30-5, 2015
Created on 2015-12-03 11:34:42,
Last reviewed on 2022-05-13 12:41:55 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.