
IthaID: 3066
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | IVS I-108 T>C | HGVS Name: | HBB:c.93-23T>C |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GATAGGCACTGACTCTCTCTGCCTA [C>T] TGGTCTATTTTCCCACCCTTAGGCT (Strand: -)
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | Unclear |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70794 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Cryptic splice site (mRNA Processing) |
Ethnic Origin: | Iranian, European, Cuban |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Badens C, Jassim N, Martini N, Mattei JF, Elion J, Lena-Russo D, Characterization of a new polymorphism, IVS-I-108 (T-->C), and a new beta-thalassemia mutation, -27 (A-->T), discovered in the course of a prenatal diagnosis., Hemoglobin, 23(4), 339-44, 1999
- Muñiz A, Martinez G, Lavinha J, Pacheco P, Beta-thalassaemia in Cubans: novel allele increases the genetic diversity at the HBB locus in the Caribbean., Am. J. Hematol. , 64(1), 7-14, 2000
- Boussiou M, Karababa P, Sinopoulou K, Tsaftaridis P, Plata E, Loutradi-Anagnostou A, The molecular heterogeneity of beta-thalassemia in Greece., Blood Cells Mol. Dis. , 40(3), 317-9, 2008
- Vinciguerra M, Cassarà F, Cannata M, Renda D, Calvaruso G, Leto F, Passarello C, Maggio A, Giambona A, Phenotypic evaluations of HBB:c.93-23T>C, a nucleotide substitution in the IVS I nt 108 of β-globin gene., J. Clin. Pathol. , 2017
Created on 2016-09-06 13:05:38,
Last reviewed on 2022-10-21 09:45:17 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.