
IthaID: 3180
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | 3'UTR +62 A>G | HGVS Name: | HBB:c.*62A>G |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCTTTGTTCCCTAAGTCCAACTACT [A/G] AACTGGGGGATATTATGAAGGGCC (Strand: -)
Comments: Found during a routine molecular analysis. Based on the normal hematology and clinical expression in the mother and child (both carriers for the novel single nucleotide variant), the mutation is likely non-pathogenic.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72080 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | Middle East, Turkish |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Arpaci A, Gul BU, Ozcan O, Ilhan G, El C, Dirican E, Elmacioglu S, Kaya H, Presentation of two new mutations in the 3'untranslated region of the β-globin gene and evaluating the molecular spectrum of thalassemia mutations in the Mediterranean region of Turkey., Ann Hematol, 100(6), 1429-1438, 2021
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Traeger Synodinos, Jan | 2017-02-15 | First report. |
Created on 2017-02-17 15:56:53,
Last reviewed on 2022-07-13 10:33:54 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.