IthaID: 3306
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 25/26 -GTG [-Gly] | HGVS Name: | HBB:c.77_79delGTG |
Hb Name: | Hb M Dothan | Protein Info: | β 25(B7) - 26(B8) Gly-Glu->0 AND inserted Glu |
Context nucleotide sequence:
CAAGGTGAACGTGGATGAAGTTGGTG [-/GTG] AGGCCCTGGGCAGGTTGGTATCAA (Strand: -)
Also known as: Hb Higashitochigi, Hb HT
Comments: Hb M-Dothan associates with the methemoglobin (Met-Hb) phenotype due to a 3 bp deletion causing a single amino acid [-Gly] deletion in the B-helix (B7/B8) of the β globin chain. The in-frame deletion disrupts the close spatial relation between the helical segments B and E and, as a result, indirectly distorts the heme pocket on the E-helix. Found in a young Japanese boy and a 9-months American boy, both presenting with cyanosis.
External Links
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-chain variant |
Allele Phenotype: | Methemoglobinaemia |
Stability: | Unstable |
Oxygen Affinity: | Decreased Oxygen Affinity |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70671 |
Size: | 3 bp |
Located at: | β |
Specific Location: | Exon 1 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Japanese, American |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Fujisawa K, Yamashiro Y, Hattori Y, Ohha Y, Kajita T, Kageyama S, Arita J, Hb Higashitochigi (Hb Ht) [ beta 24(B6) or beta 25(B7) glycine deleted]: a new unstable variant expressing cyanosis., Hemoglobin, 17(5), 467-73, 1993 PubMed
- Kutlar F, Hilliard LM, Zhuang L, Patel N, Eroglu B, Meiler SE, Carmichael H, Russell RB, Kutlar A, Hb M Dothan [beta 25/26 (B7/B8)/(GGT/GAG-->GAG//Gly/Glu-->Glu]; a new mechanism of unstable methemoglobin variant and molecular characteristics., Blood Cells Mol. Dis. , 43(3), 235-8, 2009 PubMed
Created on 2018-02-06 17:23:02,
Last reviewed on 2021-01-13 08:15:42 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2018-02-06 17:23:02 | The IthaGenes Curation Team | Created |
2 | 2021-01-13 08:15:42 | The IthaGenes Curation Team | Reviewed. Merged with IthaID: 884. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2023-03-22 16:46:31