IthaID: 341

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: Init CD ATG>GTG HGVS Name: HBA1:c.1A>G
Hb Name: N/A Protein Info: α1 nt 38 A>G
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCCACAGACTCAGAGAGAACCCACC [A/G] TGGTGCTGTCTCCTGCCGACAAGAC (Strand: +)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37580
Size: 1 bp
Located at: α1
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Initiation codon (Translation)
Ethnic Origin: Mediterranean, Sardinian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Paglietti E, Galanello R, Moi P, Pirastu M, Cao A, Molecular pathology of haemoglobin H disease in Sardinians., Br. J. Haematol. , 63(3), 485-96, 1986
  2. Moi P, Cash FE, Liebhaber SA, Cao A, Pirastu M, An initiation codon mutation (AUG----GUG) of the human alpha 1-globin gene. Structural characterization and evidence for a mild thalassemic phenotype., The Journal of clinical investigation, 80(5), 1416-21, 1987
Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-08 17:04:16 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.