
IthaID: 3572
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 90‐92 (-8bp): (‐AGCTTCGG) | HGVS Name: | HBA2:c.272_279delAGCTTCGG |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTGAGCGACCTGCACGCGCACA [-/AGCTTCGG] GTGGACCCGGTCAACTTCAAG (Strand: +)
Comments: Reported in trans with the southeast Asian type deletion α-thalassemia (--SEA) in two Chinese probands affected with hemoglobin H disease. Also found in a heterozygous and a homozygous state in family members of these probands. The deletion was detected by NGS and CE, and confirmed by gap-PCR and sequencing analysis.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34164 |
| Size: | 8 bp |
| Located at: | α2 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Li Y, Liang L, Tian M, Qin T, Wu X, Detection of Hb H disease caused by a novel mutation and -- deletion using capillary electrophoresis., J. Clin. Lab. Anal., 33(7), e22949, 2019
- Lyu J, Mo X, Li X, [Genetic testing and pedigree analysis for a case with intermediate α-thalassemia[--/αα]]., Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 39(12), 1398-1401, 2022
Created on 2020-02-19 17:37:49,
Last reviewed on 2023-01-11 14:49:36 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.