IthaID: 3572
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 90‐92 (-8bp): (‐AGCTTCGG) | HGVS Name: | HBA2:c.272_279delAGCTTCGG |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CTGAGCGACCTGCACGCGCACA [-/AGCTTCGG] GTGGACCCGGTCAACTTCAAG (Strand: +)
Also known as:
Comments: Reported in trans with the southeast Asian type deletion α-thalassemia (--SEA) in two Chinese probands affected with hemoglobin H disease. Also found in a heterozygous and a homozygous state in family members of these probands. The deletion was detected by NGS and CE, and confirmed by gap-PCR and sequencing analysis.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α⁺ |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34164 |
Size: | 8 bp |
Located at: | α2 |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Li Y, Liang L, Tian M, Qin T, Wu X, Detection of Hb H disease caused by a novel mutation and -- deletion using capillary electrophoresis., J. Clin. Lab. Anal., 33(7), e22949, 2019
- Lyu J, Mo X, Li X, [Genetic testing and pedigree analysis for a case with intermediate α-thalassemia[--/αα]]., Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 39(12), 1398-1401, 2022
Created on 2020-02-19 17:37:49,
Last reviewed on 2023-01-11 14:49:36 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-02-19 17:37:49 | The IthaGenes Curation Team | Created |
2 | 2020-02-19 17:41:44 | The IthaGenes Curation Team | Reviewed. Reference added. |
3 | 2023-01-11 14:49:36 | The IthaGenes Curation Team | Reviewed. Common name corrected. Reference added. Comment updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02