IthaID: 359

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS I-1 (-5 bp) GAGGTGAGG>GAGG----- donor HGVS Name: HBA2:c.95+2_95+6delTGAGG
Hb Name: N/A Protein Info: α2 nts 134-138 deleted
Also known as: α-5nt

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GTATGGTGCGGAGGCCCTGGAGAGG [-/TGAGG] CTCCCTCCCCTGCTCCGACCCGGGC (Strand: +)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33872
Size: 5 bp
Located at: α2
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: Mediterranean, Middle East, Dutch, Moroccan
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Orkin SH, Goff SC, Hechtman RL, Mutation in an intervening sequence splice junction in man., Proceedings of the National Academy of Sciences of the United States of America, 78(8), 5041-5, 1981
  2. Felber BK, Orkin SH, Hamer DH, Abnormal RNA splicing causes one form of alpha thalassemia., Cell , 29(3), 895-902, 1982
  3. Harteveld KL, Heister AJ, Giordano PC, Losekoot M, Bernini LF, Rapid detection of point mutations and polymorphisms of the alpha-globin genes by DGGE and SSCA., Hum. Mutat. , 7(2), 114-22, 1996
Created on 2010-06-16 16:13:15, Last reviewed on 2022-11-10 12:49:31 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.