IthaID: 3673

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -73 A>G HGVS Name: HBB:c.-123A>G
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CACCCTGTGGAGCCACACCCTAGGGTTGGCCA [A/G] TCTACTCCCAGGAGCAGGGAGGGCAGGAGCCA (Strand: -)

Comments: Identified in two Malay females and in Palestinian refugees with sickle cell disease in Lebanon.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70472
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Malay, Palestinian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Moussa EY, Yassine NM, Borjac JM, New variants in beta globin gene among the Palestinian refugees with sickle cell disease in Lebanon., Saudi Med J, 39(12), 1253-1258, 2018

Microattributions

A/AContributor(s)DateComments
1Mohd Yasin, Norafiza 2020-10-20First report.
Created on 2020-10-23 10:48:50, Last reviewed on 2025-03-17 11:13:39 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.