IthaID: 3682
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | IVS II-180 (T>C) | HGVS Name: | HBB:c.315+180T>C |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGT [T/C] TTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTT
Comments: Found in nine individuals (six Malay, one Chinese, one Asian and one with unknown origin). The novel mutation found in combination with the rightward –α3.7 deletion [IthaID: 300] in a 24-year-old female presented with elevated Hb A2 (5.8 %) level and slightly decreased MCV (77.6 fL) and MCH (24.6 pg). However, in a 24-year-old male, the mutation found with combination with the rightward –α3.7 deletion, but showed normal hematological indices with only slightly elevated Hb A2 (3.4 %) level.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71219 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Malay, Chinese, Ibany |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Mohd Yasin, Norafiza | 2020-10-20 | First report. |