IthaID: 3687
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
---|---|---|---|
Common Name: | IVS II-806 (G>C) | HGVS Name: | HBB:c.316-45G>C |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TAAGGCTGGATTATTCTGAGTCCAAGCTAG [G/C] CCCTTTTGCTAATCATGTTCATACCTCTTAT (Strand: -)
Also known as:
Comments: Found in twenty Malay and Chinese individuals presented with slightly to moderate decreased levels of MCV and MCH, in the first report.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71845 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Intron 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Chinese, Malay |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Luo S, Chen X, Zeng D, Tang N, Yuan D, Zhong Q, Mao A, Xu R, Yan T, The value of single-molecule real-time technology in the diagnosis of rare thalassemia variants and analysis of phenotype-genotype correlation., J Hum Genet, 67(4), 183-195, 2022
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Li, Youqiong | 2021-03-09 | Report of an update. |
Created on 2020-10-27 14:16:16,
Last reviewed on 2023-02-21 14:54:29 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-10-27 14:16:16 | The IthaGenes Curation Team | Created |
2 | 2021-03-10 20:43:42 | The IthaGenes Curation Team | Reviewed. Comment and contributor added. |
3 | 2022-01-03 09:17:33 | The IthaGenes Curation Team | Reviewed. Link added. |
4 | 2022-09-26 12:50:13 | The IthaGenes Curation Team | Reviewed. Reference added. |
5 | 2023-02-21 14:54:29 | The IthaGenes Curation Team | Reviewed. Link added |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45