IthaID: 3720



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 1/2 (+TG) HGVS Name: HBA2:c.6_7insTG
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GACTCAGAGAGAACCCACCATGGTGC [-/TG] TGTCTCCTGCCGACAAGACCAACGTC (Strand: +)

Comments: Found in two unrelated individuals. One of them was a 12-month old male infant with reduced Hb 9.0 g/dL, MCV 59.2 fL MCH 17.8 pg. The second individual was a 36-year old woman presented with marginally normal hematological indices (Hb 11.7 g/dL, MCV 80.6 fL, MCH 26 pg). Direct DNA sequencing showed that this mutation was inherited from her mother and her two daughters were both heterozygous for this mutation presented with slightly reduced MCV and MCH. The 2-bp insertion resulting in a completely different polypeptide from the original a2-globin peptide.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33781
Size: 2 bp
Located at: α2
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2021-01-30 14:49:20, Last reviewed on 2021-01-30 14:52:39 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.