IthaID: 3784
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | CD 133 GTG>GTC [Val>Val] | HGVS Name: | HBB:c.402G>C |
Context nucleotide sequence:
ATGGCGCCTTCCTCTCAGGGCAG [G/C] GGATCACGCGGGTTGCGGGAGGT (Strand: -)
Also known as:
Comments: Variation is reported in ClinVar as Conflicting interpretations of pathogenicity Benign(1);Likely benign(3);Uncertain significance(4) with an 1-star review status (criteria provided, conflicting interpretations).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71976 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Pianezze G, Toniolo M, Taddei Masieri M, Dolcini B, Ravani A, Hb Belluno [β111(G13)Val→Gly;β133(H11)Val→Val (HBB: c.335T > G;402G > C)]: Incidental Detection of a New Clinically Silent β Chain Variant During Hb A1c Determination by High Performance Liquid Chromatography., Hemoglobin , 40(3), 143-9, 2016 PubMed
- Carlice-Dos-Reis T, Viana J, Moreira FC, Cardoso GL, Guerreiro J, Santos S, Ribeiro-Dos-Santos Â, Investigation of mutations in the HBB gene using the 1,000 genomes database., PLoS One, 12(4), e0174637, 2017 PubMed
Created on 2021-04-05 13:01:33,
Last reviewed on (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2021-04-05 13:01:33 | The IthaGenes Curation Team | Created |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45