IthaID: 3784
Names and Sequences
Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | CD 133 GTG>GTC [Val>Val] | HGVS Name: | HBB:c.402G>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AGTGCAGGCTGCCTATCAGAAAGT [G/C] GTGGCTGGTGTGGCTAATGCCCTG (Strand: -)
Comments: Variation is reported in ClinVar as Conflicting interpretations of pathogenicity Benign(1);Likely benign(3);Uncertain significance(4) with an 1-star review status (criteria provided, conflicting interpretations).
Phenotype
Allele Phenotype: | Neutral |
---|---|
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71976 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Splice junction (mRNA Processing), Missense codons (Protein Structure) |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Pianezze G, Toniolo M, Taddei Masieri M, Dolcini B, Ravani A, Hb Belluno [β111(G13)Val→Gly;β133(H11)Val→Val (HBB: c.335T > G;402G > C)]: Incidental Detection of a New Clinically Silent β Chain Variant During Hb A1c Determination by High Performance Liquid Chromatography., Hemoglobin , 40(3), 143-9, 2016 PubMed
- Carlice-Dos-Reis T, Viana J, Moreira FC, Cardoso GL, Guerreiro J, Santos S, Ribeiro-Dos-Santos Â, Investigation of mutations in the HBB gene using the 1,000 genomes database., PLoS One, 12(4), e0174637, 2017 PubMed
Created on 2021-04-05 13:01:33,
Last reviewed on 2025-02-12 09:24:43 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.