IthaID: 3863


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: 3'UTR +1 G>A HGVS Name: HBB:c.*1G>A
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TGCCCTGGCCCACAAGTATCACTAA [G/A] CTCGCTTTCTTGCTGTCCAATTTCTA (Strand: -)

Also known as:

Comments: Found in a 15-year-old female in a 7-year study evaluating the relationship between Hb indices and thalassemia mutations.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72019
Size: 1 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Turkish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Arpaci A, Gul BU, Ozcan O, Ilhan G, El C, Dirican E, Elmacioglu S, Kaya H, Presentation of two new mutations in the 3'untranslated region of the β-globin gene and evaluating the molecular spectrum of thalassemia mutations in the Mediterranean region of Turkey., Ann Hematol, 100(6), 1429-1438, 2021
  2. Targholi S, Noormohammadi Z, Tafsiri E, Karimipoor M, Evaluation of the Function of a Rare Variant in the 3'-Untranslated Region of the β-Globin Gene., Hemoglobin, 46(6), 312-316, 2022
Created on 2021-09-28 12:21:13, Last reviewed on 2023-07-04 11:45:53 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.