IthaID: 3965
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 84-87 (-CTTTGCCACA) (+TTTTTCTCAG) | HGVS Name: | HBB:c.255_264delinsTTTTTCTCAG |
Hb Name: | Hb Wanjiang | Protein Info: | N/A |
Context nucleotide sequence:
CCTGGACAACCTCAAGGGCAC [CTTTGCCACA/TTTTTCTCAG] CTGAGTGAGCTGCACTGTGAC (Strand: -)
Also known as: Hb Donguan-Dongcheng
Comments: Found in a male and his father presented with normal hematological features. The variant results from a 10 bp deletion at codons 84-87 of the β-globin chain, replaced with 10 nucleotides coming from the δ-globin gene at the same position, leading to the substitution of two amino acids in the peptide chain with no change in the β-globin chain length. The abnormal Hb variant was not detectable by CE and HPLC. Found in 8 healthy individuals from southern China during premarital/antenatal screening.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-chain variant |
Allele Phenotype: | N/A |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70979 |
Size: | 10 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Wu SM, Jiang F, Li C, Guo ZT, Huang SR, Li DZ, Hb Wanjiang: A New β-Globin Chain Variant with Two Amino Acid Substitutions (: c.255_264delinsTTTTTCTCAG)., Hemoglobin, 2022 PubMed
- Zhang Q, Wang G, Sun D, Lin W, Yan T, Wu Y, Wu M, Chen J, Zou S, Xie W, Zhou Y, Wang Y, He L, Liu Y, Qiu Z, Hu L, Lin B, Zhou X, Li Y, Xu X, MALDI-TOF-MS for Rapid Screening and Typing of β-Globin Variant and β-Thalassemia through Direct Measurements of Intact Globin Chains., Clin Chem, 2022 PubMed
Created on 2022-09-07 08:44:28,
Last reviewed on 2022-12-06 12:54:41 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2022-09-07 08:44:28 | The IthaGenes Curation Team | Created |
2 | 2022-12-06 12:54:41 | The IthaGenes Curation Team | Reviewed. Reference and Synonym name added. Comment edits. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2023-03-22 16:46:31