IthaID: 4028


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -86 C>T HGVS Name: HBB:c.-136C>T
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AGACCTCACCCTGTGGAGCCACACC [C>T] TAGGGTTGGCCAATCTACTCCCAGG (Strand: -)

Also known as:

Comments: Transcriptional mutant in the proximal CACC box.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70459
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Cao A, Galanello R, Beta-thalassemia., Genet Med, 12(2), 61-76, 2010
Created on 2023-06-21 09:08:12, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.