IthaID: 4068
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 112 CAC>-AC | HGVS Name: | HBA2:c.337delC |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTGCCTGCTGGTGACCCTGGCCGCC [C/-] ACCTCCCCGCCGAGTTCACCCCT (Strand: +)
Comments: The deletion of a nucleotide 'C' in exon 3 of the α2-globin gene causes a frameshift resulting in a premature termination codon (TGA) at codon 132. Found via next generation sequencing and confirmed by Sanger sequencing. No other variations in HBB, HBA2 and HBA1 genes were detected. The proband had normal Hb (119 g/L), but a slightly decreased mean corpuscular volume (MCV, 77.2 fL) and mean corpuscular hemoglobin (MCH, 25.6 pg). Also, Hb A (97.8%) and Hb F (0.0%) values by CE (Capillarys 2 FIEX PIERCING, Sebia) were normal, while the Hb A2 (2.2%) value was below normal, which indicates a phenotype of silent α-thalassemia.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34371 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Pan, Lei | 2023-09-11 | First report. |