IthaID: 4077
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 37 CCC>CC- | HGVS Name: | HBA1:c.114del |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CCGCAGGATGTTCCTGTCCTTCCC [C/-] ACCACCAAGACCTACTTCCCGCACT (Strand: +)
Also known as:
Comments: Detected in a heterozygous state in a pregnant female presenting with mild hypochromic anemia. Functional analysis revealed that this variation considerably reduced the expression of the HBA1 protein.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37810 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Zhang W, Han X, Deng J, Zhou R, Du X, Wu C, Li M, Two Novel α-Thalassemia Mutations CD 39 -C [Thr > Pro] and CD 109 ACC > CCC [Thr > Pro] Identified in Two Chinese Families: A Case Report., Hemoglobin, 47(4), 172-179, 2023
Created on 2023-11-13 13:05:45,
Last reviewed on 2023-11-13 13:19:33 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.