
IthaID: 4174
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | TTS +4/5 (+T) | HGVS Name: | HBA1:c.*115_116insT |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAAGTCTGAGTGGGCGGCAGCCT [-/T] GTGTGTGCCTGAGTTTTTTCCCTCA (Strand: +)
Comments: Insertion of a single thymine (T) located five nucleotides downstream of the transcription termination signal (TTS +5). The variant lies within regulatory elements of the HBA1 3′UTR and is predicted to interfere with post-transcriptional regulation by altering local RNA secondary structure, impairing HuR/AUF1 binding, and potentially affecting poly(A) tail processing. It was identified in a 3-year-old Nigerian boy presenting with persistent microcytosis and hypochromia, and mild anemia, with no history of blood transfusions.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 38389 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | Nigerian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Benito SF, Abío M, Bardón-Cancho EJ, Nieto JM, Ortega B, González FA, Villegas A, Benavente C, Ropero P, Importance of the 3'UTR region in globin synthesis: identification of two novel HBA1 mutations causing α-Thalassemia., Ann Hematol, 2025