IthaID: 4175



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: TTS +39 C>A HGVS Name: HBA1:c.*150C>A
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGAGTTTTTTCCCTCAGCAAACGTG [C>A] CAGGCATGGGCGTGGACAGCAGCT (Strand: +)

Comments: Missense variant located 39 nucleotides downstream of the transcription termination signal. The variant lies within regulatory elements of the HBA1 3′UTR and is predicted to disrupt post-transcriptional regulation through potential interference with HuR and/or miRNA binding, leading to reduced mRNA stability. It was identified in a 31-year-old Moroccan woman with microcytosis and no history of blood transfusions.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 38424
Size: 1 bp
Located at: α1
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Moroccan
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Benito SF, Abío M, Bardón-Cancho EJ, Nieto JM, Ortega B, González FA, Villegas A, Benavente C, Ropero P, Importance of the 3'UTR region in globin synthesis: identification of two novel HBA1 mutations causing α-Thalassemia., Ann Hematol, 2025 PubMed
Created on 2025-12-17 15:22:02, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.