IthaID: 4190
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -27 (A>C) | HGVS Name: | HBB:c.‑77A>C |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AGGGCAGGAGCCAGGGCTGGGCATAA [A/C] AGTCAGGGCAGAGCCATCTATTGCTTA (Strand: -)
Comments: Identified in a Chinese family by targeted next-generation sequencing and confirmed by Sanger sequencing. The proband and her father, both heterozygous for the variant, exhibited a β⁺-thalassemia trait phenotype characterized by mild microcytosis, hypochromia, and elevated Hb A₂ levels, with no other severe clinical complications reported. Protein stability and oxygen affinity were not assessed. The variant was classified as likely pathogenic according to the ACMG/AMP guidelines (PM1, PM2_Supporting, PP3, and PS4_Moderate) and submitted to ClinVar.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70518 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Shen, Shichun | 2026-10-13 | First report. |