
IthaID: 428
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | 3'UTR -16 bp | HGVS Name: | HBA2:c.*74_*89delCCTTCCTGGTCTTTGA |
| Hb Name: | N/A | Protein Info: | α2 nts 799 - 814 deleted |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCCCTCCTCCCCTCCTTGCACCGGC [-/CCTTCCTGGTCTTTGA] ATAAAGTCTGAGTGGGCAGCAGCCT (Strand: +)
Comments: 3'UTR -16 bp (giving rise to CATAAA)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α+/α0 |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34537 |
| Size: | 16 bp |
| Located at: | α2 |
| Specific Location: | 3'UTR, Poly(A) |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | Arab |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Tamary H, Klinger G, Shalmon L, Attias D, Fortina P, Kobayashi M, Surrey S, Zaizov R, alpha-thalassemia caused by a 16 bp deletion in the 3' untranslated region of the alpha 2-globin gene including the first nucleotide of the poly A signal sequence., Hemoglobin, 21(2), 121-30, 1997
Created on 2010-06-16 16:13:15,
Last reviewed on 2023-07-14 11:54:28 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.