IthaID: 724
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 119/120 +ATC [+Ile] | HGVS Name: | HBA1:c.354_355insATC |
| Hb Name: | Hb Phnom Penh | Protein Info: | I- inserted between codons 117(GH5) and 118(H1) of α1 |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCGCCCACCTCCCCGCCGAGTTC [-/ATC] ACCCCTGCGGTGCACGCCTCCCT (Strand: +)
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
| Allele Phenotype: | α⁺ |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 38200 |
| Size: | 3 bp |
| Located at: | α1 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | Chinese, Cambodian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Zhai YS, Tang HS, Zhou JY, Li DZ, A novel case of Hb Phnom Penh: codons 117/118 (+ATC) as a cause of α+ -thalassemia., Hemoglobin , 36(3), 289-92, 2012
Created on 2010-06-16 16:13:16,
Last reviewed on 2025-09-10 13:03:46 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.