IthaID: 10
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | -87 C>G | HGVS Name: | HBB:c.-137C>G |
| Hb Name: | N/A | Protein Info: | β nt -87 C>G |
Context nucleotide sequence:
TAGACCTCACCCTGTGGAGCCACAC [A/C/G/T] CTAGGGTTGGCCAATCTACTCCCAG (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β++ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70458 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Mediterranean |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Treisman R, Orkin SH, Maniatis T, Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes., Nature, 302(5909), 591-6, 1983
- Diaz-Chico JC, Yang KG, Stoming TA, Efremov DG, Kutlar A, Kutlar F, Aksoy M, Altay C, Gurgey A, Kilinc Y, Mild and severe beta-thalassemia among homozygotes from Turkey: identification of the types by hybridization of amplified DNA with synthetic probes., Blood , 71(1), 248-51, 1988
- Camaschella C, Alfarano A, Gottardi E, Serra A, Revello D, Saglio G, The homozygous state for the -87 C----G beta + thalassaemia., Br. J. Haematol. , 75(1), 132-3, 1990
- Gilman JG, Manca L, Frogheri L, Pistidda P, Guiso L, Longinotti M, Masala B, Mild beta+(-87)-thalassemia CACCC box mutation is associated with elevated fetal hemoglobin expression in cis., Am. J. Hematol. , 45(3), 265-7, 1994
- Ilhan O, Beksaç M, Koç H, Akan H, Keskin A, Arslan O, Gürman G, Ozcan M, Konuk N, Uysal A, HLA-DR frequency in Turkish aplastic anemia patients and the impact of HLA-DR2 positivity in response rate in patients receiving immunosuppressive therapy., Blood , 86(5), 2055, 1995
Created on 2010-06-16 16:13:14,
Last reviewed on 2019-11-04 14:01:24 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.