IthaID: 17

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -50 G>A HGVS Name: HBB:c.-100G>A
Hb Name: N/A Protein Info: β nt -50 G>A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CAATCTACTCCCAGGAGCAGGGAGG [A/G] CAGGAGCCAGGGCTGGGCATAAAAG (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:Unclear
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70495
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Li DZ, Liao C, Xie XM, Zhou JY, A novel mutation of -50 (G-->A) in the direct repeat element of the beta-globin gene identified in a patient with severe beta-thalassemia., Annals of hematology, 88(11), 1149-50, 2009
Created on 2010-06-16 16:13:14, Last reviewed on 2014-01-16 12:56:49 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.