IthaID: 174
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 66 AAA>TAA [Lys>STOP] | HGVS Name: | HBB:c.199A>T |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCCTAAGGTGAAGGCTCATGGCAAG [A>T] AAGTGCTCGGTGCCTTTAGTGATGGCC (Strand: -)
Comments: Reported in two unrelated cases of beta-thalassemia.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70923 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Nonsense codon (Translation) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Waye JS, Hanna M, Hohenadel BA, Nakamura L, Walker L, Eng B, Nfonsam LE, β-Thalassemia Caused by a Novel Nonsense Mutation [c.199A > T]., Hemoglobin, 2024
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Waye, John S. | 2023-08-08 | First report. |
Created on 2010-06-16 16:13:15,
Last reviewed on 2024-04-04 09:18:41 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.