Loading... Please wait!
Quick filtering
Showing all entries with β0 phenotype (Show All):
Functionality:'Globin gene causative mutation'
Allele Phenotype:'β0'
Functionality:'Globin gene causative mutation'
Allele Phenotype:'β0'
IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
---|---|---|---|---|---|---|---|---|
291 | Czech (4237 bp deletion) | N/A | NG_000007.3:g.67258_71501del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
293 | Cape Verdean | N/A | NG_000007.3:g.71548_79271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
294 | Asian Indian (10329 bp deletion) | N/A | NG_000007.3:g.(67531_67533)_(77874_77876)del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
295 | Australian (Anglo Saxon) (12023 bp deletion) | N/A | NC_000011.10:g.5215894_5227926del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
299 | Italian (~67 kb deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
2123 | 7719 bp deletion | N/A | NG_000007.3:g.71550_79270del7719 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
3792 | N/A | Hb Lepore-Hong Kong | NG_000007.3:g.63154_70565del | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 63154 |
4109 | N/A | Hb Lepore-Quanzhou | NG_000007.3:g.63511_70924del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 63511 |
3394 | 223 kb deletion | N/A | NC_000011.10:g.5010012_5232933del | δ, β | Causative | β-thalassaemia | NG_000007.3 | 64683 |
3958 | 8.2 kb deletion | N/A | NG_000007.3:g.65147_73407del | β | Causative | β-thalassaemia | NG_000007.3 | 65147 |
298 | Filipino (~45 kb deletion) | N/A | NC_000011.10:g.5112882 _5231358del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66258 |
292 | Turk (~7.6 kb deletion) | N/A | NG_000007.3:g.[52524_60162del;66278_73952del] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66278 |
2283 | South-Italy | N/A | NC_000011.10:g.5164564_5230714del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66902 |
3997 | 7.2 kb deletion | N/A | NC_000011.10:g.5222800_5230034del | β | Causative | β-thalassaemia | NG_000007.3 | 67582 |
296 | Dutch (12620 bp deletion) | N/A | NG_000007.3:g.68071_80682del12612 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 68071 |
3823 | 60 kb deletion (Prachinburi β0-thalassemia deletion) | N/A | NC_000011.10:g.5167971_5228123delinsA | β | Causative | β-thalassaemia | NG_000007.3 | 69493 |
289 | Croatian (1605 bp deletion) | N/A | NG_000007.3:g.69561_71164del1604 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69561 |
3393 | 3.5 kb deletion (Thai, 3485 bp deletion) | N/A | NC_000011.10:g.5224302_5227791del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69825 |
288 | Black, British (1393 bp deletion) | N/A | NG_000007.3:g.70060_71452del1393 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70060 |
2125 | Afghan (909 bp deletion) | N/A | NG_000007:g.70067_70976del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70067 |
284 | 468 bp deletion | N/A | NG_000007.3:g.70070_70537del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70070 |
285 | Black (532 bp deletion) | N/A | HBB:c.-504_28del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70091 |
3277 | 538 bp deletion | N/A | HBB:c.-464_74del | NG_000007.3:g.70131_70668del | β | Causative | β-thalassaemia | NG_000007.3 | 70131 |
3278 | 1517 bp deletion | N/A | HBB:c.-390_316-169delinsA | β | Causative | β-thalassaemia | NG_000007.3 | 70205 |
2122 | 125 bp deletion | N/A | NG_000007.3:g.70360_70485del125 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70360 |
2153 | Kabylia deletion/insertion | N/A | NG_000007.3:g.70417_72458delinsATAAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70417 |
283 | 290 bp deletion | N/A | HBB:c.-176_92+25del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70419 |
282 | 105 bp deletion | N/A | HBB:c.-74_31del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70521 |
42 | Init CD ATG>GTG | N/A | HBB:c.1A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
43 | Init CD ATG>CTG | N/A | HBB:c.1A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
44 | Init CD ATG>ACG | N/A | HBB:c.2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
45 | Init CD ATG>AGG | N/A | HBB:c.2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
46 | Init CD ATG>AAG | N/A | HBB:c.2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
47 | Init CD ATG>ATC | N/A | HBB:c.3G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
48 | Init CD ATG>ATA | N/A | HBB:c.3G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
49 | Init CD ATG>ATT | N/A | HBB:c.3G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
50 | CD 1 (-G) | N/A | HBB:c.4delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70598 |
51 | CD 2-4 (-9 bp, +31 bp) | N/A | HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
3437 | CD 2 CAT>-AT | Hb Bundelkhand | HBB:c.7delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
3014 | CD 2 CAT>C-T | N/A | HBB:c.8delA | β | Causative | β-thalassaemia | NG_000007.3 | 70602 |
3561 | CD 2 CAT/CA- | N/A | HBB:c.9delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603 |
52 | CD 3 (+T) | N/A | HBB:c.11dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70605 |
55 | CD 4/5/6: CD 4 (ACT>ACA), CD 5 (CCT>TCT), CD 6 (GAG>TAG) | N/A | HBB:c.[15T>A;16C>T;19G>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70609, 70610, 70613 |
54 | CD 5 -CT | N/A | HBB:c.17_18delCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70611 |
2180 | CD 5/6 -TG | N/A | HBB:c.18_19delTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70612 |
56 | CD 6 (GAG>TAG) | N/A | HBB:c.19G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
58 | CD 6 (-G) | N/A | HBB:c.19delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
2184 | CD 6-14 (-26 bp) (26 bp deletion) | N/A | HBB:c.20_45del26bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
57 | CD 6 -A | N/A | HBB:c.20delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
59 | CD 6-10 (-13 bp) | N/A | HBB:c.21_33delGGAGAAGTCTGCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70615 |
60 | CD 7 GAG>TAG | N/A | HBB:c.22G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70616 |
2958 | CD 7/8 (+G) | N/A | HBB:c.24dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70618 |
61 | CD 8 (-AA) | N/A | HBB:c.25_26delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70619 |
2185 | CD 8/9 +AGAA | N/A | HBB:c.27_28insAGAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70620 |
62 | CD 8/9 (+G) | N/A | HBB:c.27dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
3513 | CD 8 AAG>AA- | N/A | HBB:c.27delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
63 | CD 9 (+TA) | N/A | HBB:c.28_29insTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70622 |
64 | CD 9/10 (+T) | Hb Gaziantep | HBB:c.30dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70624 |
66 | CD 10 (-C) | N/A | HBB:c.33delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
67 | CD 11 (-T) | N/A | HBB:c.36delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70630 |
68 | CD 14 (+T) | N/A | HBB:c.44dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
2553 | CD 14 CTG>C-G | N/A | HBB:c.44delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
69 | CD 14/15 (+G) | N/A | HBB:c.45dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70639 |
70 | CD 15 (-T) | N/A | HBB:c.46delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70640 |
72 | CD 15 TGG>TAG | N/A | HBB:c.47G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70641 |
73 | CD 15 TGG>TGA | N/A | HBB:c.48G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70642 |
71 | CD 15/16 (+G) | N/A | HBB:c.50dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
74 | CD 15/16 (-G) | N/A | HBB:c.50delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
75 | CD 16 GGC>GG- | N/A | HBB:c.51delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
77 | CD 17 AAG>TAG [Lys>STOP] | N/A | HBB:c.52A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70646 |
78 | CD 17 (+A) | N/A | HBB:c.53dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70647 |
3609 | CD 20/21 (-TGGA) | N/A | HBB:c.62_65delTGGA | β | Causative | β-thalassaemia | NG_000007.3 | 70656 |
81 | CD 20/21 (+G) | N/A | HBB:c.64dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
83 | CD 22 (GAA>TAA) | N/A | HBB:c.67G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70661 |
84 | CD 22-24 ( -7 bp): (-AAGTTGG) | N/A | HBB:c.68_74delAAGTTGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70662 |
85 | CD 24 (-G, +CAC) | N/A | HBB:c.74delinsCAC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
2174 | CD 24 -G | N/A | HBB:c.74delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
281 | IVS I [3 end] -44 bp (44 bp deletion) | N/A | HBB:c.76_92+27del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70670 |
87 | CD 25/26 (+T) | N/A | HBB:c.78dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70672 |
89 | CD 26 (GAG>TAG) | N/A | HBB:c.79G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
90 | CD 26 (+T) | N/A | HBB:c.79_80insT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
92 | CD 27/28 (+C) | N/A | HBB:c.85dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
93 | CD 28 (-C) | N/A | HBB:c.85delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
95 | CD 28/29 (-G) | N/A | HBB:c.89delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70683 |
97 | CD 30 (A>G) or IVS I (-2) AGG>GGG (Arg>Gly) | N/A | HBB:c.91A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
3484 | CD 30 (-A) or IVS I (-2) AGG>-GG | N/A | HBB:c.91delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
99 | CD 30 (G>A) or IVS I (-1) AGG>AAG (Arg>Lys) | N/A | HBB:c.92G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70686 |
100 | CD 30 (G>C) or IVS I (-1) AGG>ACG (Arg>Thr) (Hb Kairouan) | Hb Monroe | HBB:c.92G>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70686 |
101 | IVS I-1 G>A | N/A | HBB:c.92+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
102 | IVS I-1 (G>T) | N/A | HBB:c.92+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
103 | IVS I-1 (G>C) | N/A | HBB:c.92+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
104 | IVS I-2 (T>G) | N/A | HBB:c.92+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
105 | IVS I-2 (T>C) | N/A | HBB:c.92+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
106 | IVS I-2 (T>A) | N/A | HBB:c.92+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
107 | IVS I-5 (G>C) | N/A | HBB:c.92+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
280 | IVS I [3' end] (-25 bp) (25 bp deletion) | N/A | NC_000011.10(NM_000518.4):c.93-22_95del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
121 | IVS I [3' end] (-17 bp) (17 bp deletion) | N/A | HBB:c.93-17_93-1delTATTTTCCCACCCTTAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70800 |
114 | IVS I-116 (T>G) | N/A | HBB:c.93-15T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70802 |
124 | IVS I [3' end] (+22bp) | N/A | NG_000007.3:g.70807_70828dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70807 |
116 | IVS I-129 (A>C) | N/A | HBB:c.93-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
117 | IVS I-129 (A>G) | N/A | HBB:c.93-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
118 | IVS I-130 G>C | N/A | HBB:c.93-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
119 | IVS I-130 (G>A) | N/A | HBB:c.93-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
125 | CD 30/31 +CGG [+Arg] | N/A | HBB:c.93_94insCGG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70817 |
126 | CD 31 (-C) | N/A | HBB:c.94delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70818 |
130 | CD 33-34 (-G) | N/A | HBB:c.102_103delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
132 | CD 35 TAC>TGC [Tyr>Cys] | N/A | HBB:c.107A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70831 |
133 | CD 35 TAC>TAA | N/A | HBB:c.108C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70832 |
3023 | CD 35 TAC>TAG | N/A | HBB:c.108C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70832 |
128 | CD 36 CCT>C-T (CD 36 (-C)) | N/A | HBB:c.110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70834 |
135 | CD 36-39 (-8 bp) | N/A | HBB:c.111_118delTTGGACCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70835 |
134 | CD 36/37 (-T) | N/A | HBB:c.112delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70836 |
138 | CD 37 (TGG>TAG) | N/A | HBB:c.113G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70837 |
136 | CD 37 (-G) | N/A | HBB:c.114delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
137 | CD 37 (TGG>TGA) | N/A | HBB:c.114G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
139 | CD 37-39 (-7 bp): (-GACCCAG) | N/A | HBB:c.114_120del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
141 | CD 38/39 (-CC) | N/A | HBB:c.117_118delCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70841 |
140 | CD 38/39 (-C) | N/A | HBB:c.118delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
142 | CD 39 CAG>TAG [Gln>STOP] | N/A | HBB:c.118C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
2393 | CD 39 -A | N/A | HBB:c.119delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70843 |
143 | CD 40 (-G) | N/A | HBB:c.123delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
144 | CD 40 (+86 bp) (HGSA) | N/A | HBB:c.123_208dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
145 | CD 40/41 (+T) | N/A | HBB:c.125dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70849 |
146 | CD 41 (-C) | N/A | HBB:c.126delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
147 | CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT)) | N/A | HBB:c.126_129delCTTT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
148 | CD 42/43 (+T) | N/A | HBB:c.129dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70853 |
2954 | CD 42 TTT>TT- | Hb Yala | HBB:c.129delT | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70853 |
149 | CD 42/43 (+G) | N/A | HBB:c.130dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
150 | CD 43 (GAG>TAG) | N/A | HBB:c.130G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
3594 | CD 43 (GAG>TAG);CD 71/72 (+A) | N/A | HBB:c.[130G>T;217dupA] | β | Causative | β-thalassaemia | NG_000007.3 | 70854, 70941 |
151 | CD 44 -C | N/A | HBB:c.135delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70859 |
152 | CD 45 (-T) | N/A | HBB:c.138delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
153 | CD 45 (+T) | N/A | HBB:c.138dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
2960 | CD 46/47 (+G) | N/A | HBB:c.142_142dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70866 |
155 | CD 47 (+A) | N/A | HBB:c.143dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
156 | CD 47/48 (+ATCT) | N/A | HBB:c.143_146dupATCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
2187 | CD 48 -T | N/A | HBB:c.146delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70870 |
157 | CD 49 (-C) | N/A | HBB:c.150delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70874 |
3940 | CD 50 ACT>TCT [Thr>Ser]; IVS II-654 C>T | Hb Zurich-Langstrasse | HBB:c.[151A>T;316-197C>T] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70875, 71693 |
158 | CD 50 (-T) | N/A | HBB:c.153delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70877 |
159 | CD 51 (-C) | N/A | HBB:c.155delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70879 |
2959 | CD 52 GAT>G-T | N/A | HBB:c.158delA | β | Causative | β-thalassaemia | NG_000007.3 | 70882 |
161 | CD 53/54 (+G) | N/A | HBB:c.163dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70887 |
162 | CD 54 -T | N/A | HBB:c.165delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
164 | CD 54-58 (-13bp) | N/A | HBB:c.165_177delTATGGGCAACCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
163 | CD 54/55 (+A) | N/A | HBB:c.166dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
165 | CD 55 (-A) | N/A | HBB:c.166delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
2990 | CD 55-59 (-13 bp) | N/A | HBB:c.167_179del | β | Causative | β-thalassaemia | NG_000007.3 | 70891 |
166 | CD 56-60 (+14 bp) | N/A | HBB:c.170_183dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70894 |
167 | CD 58 (+C) | N/A | HBB:c.176dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70900 |
3311 | CD 58 CCT>C-T | N/A | HBB:c.176delC | β | Causative | β-thalassaemia | NG_000007.3 | 70900 |
169 | CD 59 (AAG>TAG) | N/A | HBB:c.178A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70902 |
168 | CD 59 -A | N/A | HBB:c.179delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70903 |
172 | CD 61 (AAG>TAG) | N/A | HBB:c.184A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70908 |
2190 | CD 62-83 (+65 bp) | N/A | HBB:c.187_251dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70911 |
171 | CD 62-64 (-7bp) | N/A | HBB:c.189_195delTCATGGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70913 |
173 | CD 64 (-G) | N/A | HBB:c.194delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70918 |
3944 | CD 64 (+G) | N/A | HBB:c.194dup | β | Causative | β-thalassaemia | NG_000007.3 | 70918 |
174 | CD 66 AAA>TAA [Lys>STOP] | N/A | HBB:c.199A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70923 |
3854 | CD 66/67 (-AAAG) | N/A | HBB:c.199_202delAAAG | β | Causative | β-thalassaemia | NG_000007.3 | 70923 |
2188 | CD 66 -A | N/A | HBB:c.201delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70925 |
175 | CD 67 (-TG) | N/A | HBB:c.203_204delGT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70927 |
2522 | CD 69 GGT>G-T | N/A | HBB:c.209delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70933 |
2189 | CD 69 -T | N/A | HBB:c.210delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70934 |
176 | CD 71 (+T) | N/A | HBB:c.216dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70940 |
2462 | CD 71 -T | N/A | HBB:c.216delT | β | Causative | β-thalassaemia | NG_000007.3 | 70940 |
177 | CD 71/72 (+A) | N/A | HBB:c.217dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
178 | CD 72-73 (-AGTGA, +T) | N/A | HBB: c.217_221delAGTGAinsT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
2181 | CD 72/73 (+T) | N/A | HBB:c.219dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70943 |
179 | CD 75 (-C) | N/A | HBB:c.226delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70950 |
180 | CD 76 GCT>--T (-GC) | N/A | HBB:c.229_230delGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70953 |
181 | CD 76 (-C) | N/A | HBB:c.230delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70954 |
182 | CD 78 CTG>-TG | N/A | HBB:c.235delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70959 |
3299 | CD 77/78 (+C) | N/A | HBB:c.235dupC | β | Causative | β-thalassaemia | NG_000007.3 | 70959 |
3225 | CD 78/85 (-20bp) | N/A | HBB:c.237_256delGGACAACCTCAAGGGCACCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70961 |
183 | CD 80/81 (-C) | N/A | HBB:c.244delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
184 | CD 81-87 (-22 bp) | N/A | HBB:c.244_265del22 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
185 | CD 82/83 (-G) | N/A | HBB:c.251delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70975 |
186 | CD 84-86 (-8 bp): (-CACCTTTG) | N/A | HBB:c.253_260del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70977 |
187 | CD 84/85 (+C) | N/A | HBB:c.255dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70979 |
188 | CD 84-86 (+T) | N/A | HBB:c.258dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70982 |
3253 | CD 88 CTG>--G (HBB:c.265_266delCT) | N/A | HBB:c.265_266del | β | Causative | β-thalassaemia | NG_000007.3 | 70989 |
189 | CD 88 (+T) | N/A | HBB:c.266dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
190 | CD 88 (-TG) | N/A | HBB:c.266_267del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
191 | CD 89/90 (AGTGAG>AGAG) | N/A | HBB:c.270_271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70994 |
192 | CD 90 GAG>TAG | N/A | HBB:c.271G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70995 |
3057 | CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG) | N/A | HBB:c.272_295dup | β | Causative | β-thalassaemia | NG_000007.3 | 70996 |
3133 | IVS II-1 G>A and CD 91 CTG>TTG [Leu>Leu] | N/A | HBB:c.[315+1G>A; 274C>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70998, 71040 |
194 | CD 91 (+T) | N/A | HBB:c.275dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
196 | CD 95 (+A) | N/A | HBB:c.287dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71011 |
3888 | CD 97/98 (+GCAC) | N/A | HBB:c.291_294dup | β | Causative | β-thalassaemia | NG_000007.3 | 71015 |
198 | CD 100 (-CC,+TCTGAGAACTT) >158aa | N/A | HBB:c.301_302delCCinsTCTGAGAACTT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71025 |
2279 | CD 102 AAC>ATCAC | N/A | HBB:c.308insTC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71032 |
199 | IVS II-1 (-G) | N/A | HBB:c.315+1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
200 | IVS II-1 G>A | N/A | HBB:c.315+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
201 | IVS II-1 G>C | N/A | HBB:c.315+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
202 | IVS II-1 G>T | N/A | HBB:c.315+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
205 | IVS II-2 (-T) | N/A | HBB:c.315+2del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
206 | IVS II-2/3 (-2 bp, +11 bp) (IVS II-2,3 (+11/-2)) | N/A | HBB:c.315+2_315+3delinsACGTTCTCTGA | β | Causative | β-thalassaemia | NG_000007.3 | 71041 |
3226 | IVS II-2 T>G | N/A | HBB:c.315+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
207 | IVS II 4/5 -AG | N/A | NG_000007.3:g.71043_71044delAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71043 |
3996 | 4.9 Kb deletion (NG_000007.3:g.71429_76331del) | N/A | NC_000011.10:g.5226187_5231089del | β | Causative | β-thalassaemia, Ineffective erythropoiesis | NG_000007.3 | 71429 |
286 | 619 bp deletion (Asian Indian) | N/A | NG_000007.3:g.71609_72227del619 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71609 |
223 | IVS II-849 (A>G) | N/A | HBB:c.316-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
224 | IVS II-849 (A>C) | N/A | HBB:c.316-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
225 | IVS II-850 G>C | N/A | HBB:c.316-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
226 | IVS II-850 (G>A) | N/A | HBB:c.316-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
227 | IVS II-850 (G>T) | N/A | HBB:c.316-1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
228 | IVS II-850 (-G) | N/A | HBB:c.316-1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
231 | CD 107 (+G) | N/A | HBB:c.323dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
235 | CD 112 (TGT>TGA) | N/A | HBB:c.339T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
2192 | CD 114/115 (+TGTGCTG) | N/A | HBB:c.339_345dupTGTGCTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
240 | CD 116 (+TGAT) | N/A | HBB:c.349_350insTGAT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71924 |
2193 | CD 117 -C | N/A | HBB:c.354delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71928 |
3846 | CD 118 (-TT) | N/A | HBB:c.356_357delTT | β | Causative | β-thalassaemia | NG_000007.3 | 71930 |
3555 | CD 124 (+C) | N/A | HBB:c.374dup | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 71948 |
2194 | CD 124/125 (+A) | N/A | HBB:c.375dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
249 | CD 125 (-A) >156aa | N/A | HBB:c.378delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71952 |
252 | CD 126-131 (-17 bp) | Hb Westdale | HBB:c.380_396delTGCAGGCTGCCTATCAG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 71954 |
254 | CD 127 CAG>CGG [Gln>Arg] | Hb Dieppe | HBB:c.383A>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
257 | CD 128/129 (-4, +5, -11 bp) >153aa | N/A | HBB:c.[385_388delinsCCACA;397_407delAAAGTGGTGGC] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71959 |
3860 | CD 130 TAT>TAG [Tyr>STOP] | N/A | HBB:c.393T>G | β | Causative | β-thalassaemia | NG_000007.3 | 71967 |
258 | CD 131 (CAG>TAG) | N/A | HBB:c.394C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71968 |
2197 | CD 131 (+A) | N/A | HBB:c.395dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71969 |
262 | CD 132 (AAA>TAA) | N/A | HBB:c.397A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71971 |
3361 | CD 138/139 (+T) | N/A | HBB:c.417dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71991 |
1290 | CD 142 (-CC) | Hb Uzes | HBB:c.429_430delCC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72003 |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2025-06-03 04:55:16