IthaID: 2024


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 143 (-C) HGVS Name: HBB:c.430delC
Hb Name: Hb Montreal II Protein Info: N/A

Context nucleotide sequence:
CTGGTGTGGCTAATGCCCTGGCC [C/-] ACAAGTATCACTAAGCTCGCTTTC (Strand: -)

Also known as:

Comments: Single nucleotide deletion (-C) at codon 143 resulting in a frameshift and the elongation of the β-globin chain, terminating translation at codon 157.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Thalassaemia dominant
Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72004
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Canadian
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Chagnon P, Mollica L, Belisle C, Deveaux C, Angelo GD, Roy DC, Soulières D, Busque L., Hb Montreal II: a novel elongated beta-globin variant caused by a frameshift mutation [beta142 (-C)]., Hemoglobin, 32(4), 351-9, 2008
Created on 2010-10-16 11:59:51, Last reviewed on 2023-08-04 12:57:56 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.