
IthaID: 212
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | IVS II-705 (T>G) | HGVS Name: | HBB:c.316-146T>G |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATTTCTGCATATAAATTGTAACTGA [G/T] GTAAGAGGTTTCATATTGCTAATAG (Strand: -)
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β+ |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71744 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Intron 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Cryptic splice site (mRNA Processing) |
Ethnic Origin: | Mediterranean, Syrian, Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Dobkin C, Pergolizzi RG, Bahre P, Bank A, Abnormal splice in a mutant human beta-globin gene not at the site of a mutation., Proceedings of the National Academy of Sciences of the United States of America, 80(5), 1184-8, 1983
- Jiang F, Chen GL, Zhou JY, Li DZ, First Report of the Rare IVS-II-705 (T>G) β-Thalassemia Mutation in a Chinese Family., Hemoglobin, 41(0), 286-287, 2017
- Murad H, Moassas F, First Report on the Coinheritance of α-Thalassemia and a Rare β-Thalassemia Compound Heterozygosity for the IVS-I-I(G>A)/IVS-II-705(T>G) Mutations in a Syrian Family., Hemoglobin, 43(1), 66-68, 2019
Created on 2010-06-16 16:13:15,
Last reviewed on 2021-08-26 11:29:18 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.