IthaID: 2172

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -41 A>C HGVS Name: HBB:c.-91A>C
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TCCCAGGAGCAGGGAGGGCAGGAGCC [A/C] GGGCTGGGCATAAAAGTCAGGGCAGA (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70504
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Salehi R, Fisher CA, Bignell PA, Eslami G, Old JM, Identification of three novel mutations [-41 (A>C), codon 24 (-G), and IVS-I-109 (-T)], in a study of beta-thalassemia alleles in the Isfahan region of Iran., Hemoglobin , 34(1), 115-20, 2010
Created on 2013-09-30 14:35:03, Last reviewed on 2026-05-18 11:53:57 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.