
IthaID: 2176
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CAP +39 C>T | HGVS Name: | HBB:c.-12C>T |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACAACTGTGTTCACTAGCAACCT [C/T] AAACAGACACCATGGTGCATCT (Strand: -)
Comments: Reported during an epidemiological survey in a student cohort, Guangxi Zhuang Autonomous Region.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β++ (silent) |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70583 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | 5'UTR (Transcription) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Chen W, Zhang X, Shang X, Cai R, Li L, Zhou T, Sun M, Xiong F, Xu X, The molecular basis of beta-thalassemia intermedia in southern China: genotypic heterogeneity and phenotypic diversity., BMC Med. Genet. , 11(1), 31, 2010
- Xiong F, Sun M, Zhang X, Cai R, Zhou Y, Lou J, Zeng L, Sun Q, Xiao Q, Shang X, Wei X, Zhang T, Chen P, Xu X, Molecular epidemiological survey of haemoglobinopathies in the Guangxi Zhuang Autonomous Region of southern China., Clin. Genet., 78(2), 139-48, 2010
Created on 2013-09-30 15:03:21,
Last reviewed on 2022-07-15 10:03:17 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.