IthaID: 2176

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CAP +39 C>T HGVS Name: HBB:c.-12C>T
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
ACAACTGTGTTCACTAGCAACCT [C/T] AAACAGACACCATGGTGCATCT (Strand: -)

Comments: Reported during an epidemiological survey in a student cohort, Guangxi Zhuang Autonomous Region.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70583
Size: 1 bp
Located at: β
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Chen W, Zhang X, Shang X, Cai R, Li L, Zhou T, Sun M, Xiong F, Xu X, The molecular basis of beta-thalassemia intermedia in southern China: genotypic heterogeneity and phenotypic diversity., BMC Med. Genet. , 11(1), 31, 2010
  2. Xiong F, Sun M, Zhang X, Cai R, Zhou Y, Lou J, Zeng L, Sun Q, Xiao Q, Shang X, Wei X, Zhang T, Chen P, Xu X, Molecular epidemiological survey of haemoglobinopathies in the Guangxi Zhuang Autonomous Region of southern China., Clin. Genet., 78(2), 139-48, 2010
Created on 2013-09-30 15:03:21, Last reviewed on 2022-07-15 10:03:17 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.