
IthaID: 2183
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | IVS II-781 C>G | HGVS Name: | HBB:c.316-70C>G |
| Hb Name: | N/A | Protein Info: | β nt 1276 C>G |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTTTTATTTTATGGTTGGGATAAGG [C/G] TGGATTATTCTGAGTCCAAGCTAGG (Strand: -)
Comments: In the first report described as a β+ variant in a case with heterozygosity with the Hb A2’, HBD:c.49G>C [IthaID:1356], presented with elevated HbA2 4.4% but normal haematological indices. Furthermore, found in coinheritance with other α-, β- or δ-globin gene defects, shown no influence or change of this sequence variant on the expected hematological and clinical indices as simple carrier. The HBB:c.316-70C>G, was associated with Hb A2’ in most cases, suggesting that these two mutations are in linkage.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | Unclear |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71820 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016
- Vinciguerra M, Passarello C, Leto F, Crivello A, Fustaneo M, Cassarà F, Cannata M, Maggio A, Giambona A, Coinheritance of a Rare Nucleotide Substitution on the β-Globin Gene and Other Known Mutations in the Globin Clusters: Management in Genetic Counseling., Hemoglobin, 40(4), 231-5, 2016
- Grimholt RM, Harteveld CL, Arkesteijn SGJ, Fjeld B, Klingenberg O, Characterization of Two Deep Intronic Variants on the β-Globin Gene with Inconsistent Interpretations of Clinical Significance., Hemoglobin, 42(2), 126-128, 2018