IthaID: 220

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS II-844 (C>G) HGVS Name: HBB:c.316-7C>G
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TCATGTTCATACCTCTTATCTTCCT [C/G] CCACAGCTCCTGGGCAACGTGCTGG (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71883
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Consensus splice site (mRNA Processing)
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Murru S, Loudianos G, Deiana M, Camaschella C, Sciarratta GV, Agosti S, Parodi MI, Cerruti P, Cao A, Pirastu M, Molecular characterization of beta-thalassemia intermedia in patients of Italian descent and identification of three novel beta-thalassemia mutations., Blood, 77(6), 1342-7, 1991
  2. Rosatelli MC, Pischedda A, Meloni A, Saba L, Pomo A, Travi M, Fattore S, Cao A, Homozygous beta-thalassaemia resulting in the beta-thalassaemia carrier state phenotype., British journal of haematology, 88(3), 562-5, 1994
Created on 2010-06-16 16:13:15, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.