
IthaID: 2282
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 139/140 +T [163 aa] | HGVS Name: | HBB:c.420dupT |
Hb Name: | Hb Boston-Kuwait | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAAGTGGTGGCTGGTGTGGCTAAT [-/T] GCCCTGGCCCACAAGTATCACTAA (Strand: -)
Comments: Found in a young patient with an transfusion-dependent thalassaemia major phenotype. Consanguineous Kuwaiti parents and seven older siblings were healthy.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
Allele Phenotype: | Dominant |
Stability: | Unstable |
Oxygen Affinity: | N/A |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 71994 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Kuwaiti |
Molecular mechanism: | N/A |
Inheritance: | Dominant |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Croteau SE, Luo HY, Lehmann LE, Chui DH, Neufeld EJ, Novel dominant β-thalassemia: Hb Boston-Kuwait [codon 139/140(+T)]., Pediatr Blood Cancer , 60(10), E131-4, 2013
Created on 2013-10-09 13:14:07,
Last reviewed on 2019-11-13 15:25:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.