IthaID: 229



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 106 (CTG >GTG) Leu to Val HGVS Name: HBB:c.319C>G
Hb Name: Hb L'Aquila Protein Info: β 106(G8) Leu>Val

Context nucleotide sequence:
ACCTCTTATCTTCCTCCCACAGCTC [C/G] TGGGCAACGTGCTGGTCTGTGTGCT (Strand: -)

Also known as: Hb Federico II

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:β+
Thalassaemia dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71893
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Italian
Molecular mechanism: Altered heme pocket
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Amato A, Cappabianca MP, Ponzini D, Rinaldi S, Biagio PD, Foglietta E, Grisanti P, Mastropietro F, Hb L'Aquila [beta106(G8)Leu-->Val, CTG-->GTG]: a novel thalassemic hemoglobin variant., Hemoglobin, 31(3), 375-8, 2007 PubMed
  2. Grosso M, Palumbo I, Morelli E, Puzone S, Sessa R, Izzo P, Defective mRNA levels are responsible for a beta-thalassemia phenotype associated with Hb Federico II, a novel hemoglobin variant [beta-106 (G8) Leu->Val]., Haematologica , 93(7), 1096-8, 2008 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2016-12-14 10:25:38 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.