IthaID: 2347


Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 62 -G HGVS Name: HBA1:c.189delG
Hb Name: N/A Protein Info: 62 (-G); modified C-terminal sequence: (62)Val-Pro-Thr-Arg-(66)COOH

Context nucleotide sequence:
AGGTTAAGGGCCACGGCAAGAAGGT [-/G] GCCGACGCGCTGACCAACGCCGTGG (Strand: +)

Also known as:

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37885
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2014-05-22 12:31:26, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.